...
I think the structure of a gene in the current annotation is incorrect. How can I correct it?
If you have sequence data that indicate the current annotation for a gene is incorrect, please contact TAIR to update the structure.found missing information or discrepancies in the existing Col-0 gene structures, we would like to include your gene model in our database.
Please submit your data in one of the following ways:
- Send tab-delimited data from any program. If you want to create your own file please follow the following format in submitting your data and send the files to: curator@arabidopsis.org. Fields indicated in bold are required. Please include the column headers as the first line in your files.
Description file
| Field | Description | Values/Constraints | Example |
|---|---|---|---|
| Chromosome based name | At#g#####, see AGI coding convention if the gene is new, splitting or merging existing genes | AT1G23450 | |
| Gene name | gene symbolic name and/or full name | symbolic names and full names should be listed in one column and separated with a colon | AG:AGAMOUS |
| Genomic coordinates | chromosome number, start and stop coordinates on the genome, if you have mapped them | Chr1:nnnnnn..nnnnnnn | |
| Transcript Sequence | gaacaacattgagaagtcatgtaatgt | ||
| Transcript sequence type | cDNA, EST, RNAseq, other | ||
| Protein Sequence | The protein sequence will help us determine the correct translational start and stop | only for protein-coding genes | MGLVNEVELKSLLEQETDSP |
| GenBank accession | AAF79505 | ||
| Method description | method used to derive the structural annotation | full-length cDNA clone sequencing | |
| Publication | PMID or DOI |
Gene Function Additions/Modifications
I think the functional annotation for a gene is incorrect. How can I correct it?
...